ID: 1108708003

View in Genome Browser
Species Human (GRCh38)
Location 13:53007289-53007311
Sequence TGGGACACCTTGGGAGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108708003_1108708012 0 Left 1108708003 13:53007289-53007311 CCTGTGCCTCCCAAGGTGTCCCA No data
Right 1108708012 13:53007312-53007334 GCATGGGATGAAGGCCAGTGAGG No data
1108708003_1108708014 26 Left 1108708003 13:53007289-53007311 CCTGTGCCTCCCAAGGTGTCCCA No data
Right 1108708014 13:53007338-53007360 GTCTTTTCATGAGTTGCTTCTGG No data
1108708003_1108708015 27 Left 1108708003 13:53007289-53007311 CCTGTGCCTCCCAAGGTGTCCCA No data
Right 1108708015 13:53007339-53007361 TCTTTTCATGAGTTGCTTCTGGG No data
1108708003_1108708009 -9 Left 1108708003 13:53007289-53007311 CCTGTGCCTCCCAAGGTGTCCCA No data
Right 1108708009 13:53007303-53007325 GGTGTCCCAGCATGGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108708003 Original CRISPR TGGGACACCTTGGGAGGCAC AGG (reversed) Intergenic
No off target data available for this crispr