ID: 1108708615

View in Genome Browser
Species Human (GRCh38)
Location 13:53012050-53012072
Sequence CAGGTAGAACTTCTGGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108708610_1108708615 -7 Left 1108708610 13:53012034-53012056 CCATGGAAGAATCACCCAGGTAG No data
Right 1108708615 13:53012050-53012072 CAGGTAGAACTTCTGGCTGGAGG No data
1108708605_1108708615 10 Left 1108708605 13:53012017-53012039 CCACCTGAATTCCTAATCCATGG No data
Right 1108708615 13:53012050-53012072 CAGGTAGAACTTCTGGCTGGAGG No data
1108708608_1108708615 -1 Left 1108708608 13:53012028-53012050 CCTAATCCATGGAAGAATCACCC No data
Right 1108708615 13:53012050-53012072 CAGGTAGAACTTCTGGCTGGAGG No data
1108708607_1108708615 7 Left 1108708607 13:53012020-53012042 CCTGAATTCCTAATCCATGGAAG No data
Right 1108708615 13:53012050-53012072 CAGGTAGAACTTCTGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108708615 Original CRISPR CAGGTAGAACTTCTGGCTGG AGG Intergenic
No off target data available for this crispr