ID: 1108713222

View in Genome Browser
Species Human (GRCh38)
Location 13:53054612-53054634
Sequence CTCAAACAGATGTCATGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108713220_1108713222 -6 Left 1108713220 13:53054595-53054617 CCTGAGCCTTCAGTCATCTCAAA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1108713222 13:53054612-53054634 CTCAAACAGATGTCATGCCATGG 0: 1
1: 0
2: 0
3: 6
4: 152
1108713219_1108713222 23 Left 1108713219 13:53054566-53054588 CCTTCAGGATGATGTTGGGAGGT 0: 1
1: 0
2: 0
3: 23
4: 218
Right 1108713222 13:53054612-53054634 CTCAAACAGATGTCATGCCATGG 0: 1
1: 0
2: 0
3: 6
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108713222 Original CRISPR CTCAAACAGATGTCATGCCA TGG Intergenic
901246040 1:7732121-7732143 CTCTACCAGATCTCATGTCAGGG + Intronic
903955080 1:27019937-27019959 CTCAAACAGTTCTCCTGCCTAGG + Intergenic
904247190 1:29196112-29196134 CTTAGACAGCTGTCGTGCCAGGG + Intronic
904609427 1:31716874-31716896 CTCAATCAATTGTCCTGCCACGG - Intergenic
904615773 1:31748729-31748751 CACAAACAGATGTGCTGCCTGGG + Intronic
907103358 1:51857480-51857502 TTTCAACAGATGTCATGCCCAGG + Intronic
909342087 1:74543618-74543640 CTCAGGCAGATGGCATGTCAGGG - Intronic
912824070 1:112889383-112889405 CACAAACAGAAGTCATGACTTGG + Intergenic
913017286 1:114752029-114752051 CTCAAGCAGACCTCCTGCCAAGG - Intronic
914903683 1:151726968-151726990 CTGAACCAGATCTCAAGCCAGGG - Intronic
916118958 1:161511512-161511534 CTCAGACAGATGCCATGGCGTGG + Intronic
916128716 1:161593172-161593194 CTCAGACAGATGCCATGGCGTGG + Intronic
916138633 1:161675003-161675025 CTCAGACAGATGCCATGGCGTGG + Intronic
917048949 1:170896271-170896293 CTCAAAGAGAAGGAATGCCAGGG + Intergenic
917887136 1:179397965-179397987 CACAAACAGAATTCATGCTATGG - Intronic
920136607 1:203774429-203774451 CTCAAACATAGGTCATGTCGAGG + Exonic
920231852 1:204475892-204475914 CTCTGACAGATCTCATGCCCAGG + Intronic
921246988 1:213254682-213254704 GTCAAACAGATGTATTGCCAGGG - Intronic
924385174 1:243493127-243493149 CTCAAACAAAAGACAGGCCAGGG - Intronic
1068704228 10:60055703-60055725 CTCCAGCAGATGGCAAGCCAAGG - Exonic
1073367100 10:102952172-102952194 CTCAAACAGTCGTCCTGCCTTGG + Intronic
1074490941 10:113939061-113939083 CTCAAAGAGATGTGATTTCAGGG - Intergenic
1080581062 11:33644020-33644042 CTCAAAGACATTTCATGCCTGGG - Intronic
1081352278 11:42068852-42068874 TTCAAATAGATTTCCTGCCAAGG + Intergenic
1084471573 11:69362631-69362653 GTAAAGCAGATGACATGCCAAGG + Intronic
1085084585 11:73658327-73658349 TTGAAAGAGATGTCATGACATGG + Intronic
1090266433 11:125356176-125356198 CTCATGCAGCTGACATGCCAGGG - Intronic
1106993534 13:35452742-35452764 CTCAGACATATATCATGACAAGG - Intronic
1108713222 13:53054612-53054634 CTCAAACAGATGTCATGCCATGG + Intergenic
1109995485 13:70118959-70118981 CTCAAAAATATGTCAAGCCATGG + Intergenic
1113072042 13:106431467-106431489 CTCAAACAATTCTCTTGCCATGG - Intergenic
1113283736 13:108821695-108821717 TTCAAACAGATGTCCAGGCATGG + Intronic
1113320467 13:109227765-109227787 CTGAAACAGAAGTCACTCCAGGG - Intergenic
1114581162 14:23761519-23761541 CTCACACACTTCTCATGCCATGG + Intergenic
1114712849 14:24795727-24795749 TTCAAAGACATGTCATGCCCTGG - Intergenic
1118412005 14:65489799-65489821 GTAAAACAGATGGCATGGCAAGG + Intronic
1119571697 14:75680260-75680282 CTCAATCACATTTCCTGCCAGGG - Intronic
1120759032 14:88269927-88269949 CTGAAACAAATGGCATTCCAAGG + Intronic
1122341530 14:101031488-101031510 CTCAAACAGATGGAATGACCAGG - Intergenic
1123697317 15:22888496-22888518 CTCAATCAGATCTCCTGCCTGGG - Intronic
1124194830 15:27614785-27614807 ATCAAACAAAGTTCATGCCAAGG + Intergenic
1124381703 15:29172880-29172902 CTAAAACAGGTGTCCTGACAGGG - Intronic
1131276594 15:90987038-90987060 CTCAAACAGTTTTCCTGCCTCGG - Intronic
1132975781 16:2710454-2710476 CTCACACAGATGCCACGTCAGGG - Intergenic
1133901142 16:9976239-9976261 CTCACATAGTAGTCATGCCATGG - Intronic
1136930671 16:34415511-34415533 GTCACACAGTTCTCATGCCATGG + Intergenic
1136973903 16:34996297-34996319 GTCACACAGTTCTCATGCCATGG - Intergenic
1141897685 16:86969054-86969076 CTAAAACAGATGTCAGGGCAGGG + Intergenic
1142225448 16:88875052-88875074 CGCACACAGATGCCAGGCCACGG + Exonic
1142225462 16:88875116-88875138 CACACACAGATGCCAGGCCACGG + Exonic
1142225469 16:88875148-88875170 CGCACACAGATGCCAGGCCACGG + Exonic
1142225475 16:88875180-88875202 CGCACACAGATGCCAAGCCACGG + Exonic
1144624599 17:16838334-16838356 CGCAGAGCGATGTCATGCCATGG + Intergenic
1144881829 17:18434387-18434409 CGCAGAGCGATGTCATGCCATGG - Intergenic
1145150404 17:20509999-20510021 CGCAGAGCGATGTCATGCCATGG + Intergenic
1145839032 17:27978226-27978248 CTGCAACAGATGGCATGGCATGG - Intergenic
1147762454 17:42808174-42808196 CTCAAACAGTTCTCCTGCCTTGG - Intronic
1150424222 17:65064600-65064622 CTCAACCAGAGGACATGCCCTGG - Intergenic
1151256592 17:72881952-72881974 CTCTAGCAGATGTCATGGGATGG - Intronic
1151717929 17:75840829-75840851 CTCAAACCTCTGTCCTGCCAGGG - Exonic
1151845714 17:76653775-76653797 CTCAAACAGTCCTCATGCCTTGG + Intergenic
1152996650 18:413588-413610 CTCAAACAGTTCTCCTGCCTTGG - Intronic
1153393346 18:4589638-4589660 CTAAAACAGGTCTCAGGCCAAGG + Intergenic
1154100747 18:11471137-11471159 CCCCACCAGCTGTCATGCCATGG - Intergenic
1159402098 18:67951855-67951877 CTAAAACAAATATCATTCCATGG - Intergenic
1164666291 19:30040781-30040803 CTCAAGAAGAGGTCCTGCCAAGG - Intergenic
1165031541 19:33001301-33001323 CTCAAGCAGTTGTCCTGCCTTGG - Intronic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
936507062 2:113116403-113116425 CTCACCAAGATGTAATGCCAAGG - Intronic
936991539 2:118372120-118372142 CTCAAACAGATGACAAAACAAGG + Intergenic
937939122 2:127271392-127271414 CTCATTCAGATCTCATCCCATGG - Exonic
939588934 2:144039686-144039708 CTCAAACAGAAGTCAGGAAAAGG - Intronic
940991885 2:160105725-160105747 CTCCAACAAATGCCTTGCCATGG - Intronic
1172489501 20:35324019-35324041 CTCAAGCAGTTCTCCTGCCATGG - Intronic
1176703813 21:10093622-10093644 CCCAAACATATGCCAAGCCAGGG - Intergenic
1178924730 21:36765223-36765245 CGCAGACACACGTCATGCCAGGG + Intronic
1180204264 21:46247864-46247886 CTCAAACAGTTCTCCTGCCTTGG - Intronic
1181416137 22:22760281-22760303 CAAAAACAGGTGTCAGGCCAGGG + Intronic
1182935314 22:34216647-34216669 ATCACACAGATCACATGCCAGGG - Intergenic
949821651 3:8122718-8122740 CTTCACCAGATGCCATGCCATGG - Intergenic
951468974 3:23035215-23035237 CTCACAAAGTTCTCATGCCATGG + Intergenic
951668729 3:25156372-25156394 CTCAAACAGATGGGATTCCAGGG - Intergenic
952928230 3:38337958-38337980 CTCAAACATTTGTCCTGCTATGG + Intergenic
954989868 3:54831437-54831459 CCCAAACAGATGTCCTTCAAAGG + Intronic
955192277 3:56772369-56772391 CTCAAACAGTTCTCAAGTCATGG + Intronic
956204197 3:66738901-66738923 TTTACACAGATGTCAGGCCATGG + Intergenic
958194694 3:90229094-90229116 TTAAAACAGATTTAATGCCATGG - Intergenic
958695353 3:97520692-97520714 CCCAAACAGATGTAATGAAAAGG - Intronic
959013505 3:101107150-101107172 CTCAAAGAACTGTCATGTCATGG + Intergenic
961846236 3:129766299-129766321 CAGAAACAGATGTCCTGGCATGG - Intronic
968152169 3:196345558-196345580 CTCAAGCAGAAGACATGCCTCGG + Intergenic
972553582 4:40158672-40158694 CTCAAGCAGTTCTCATGCCTGGG - Intergenic
974397434 4:61356585-61356607 AGCAAACACATGTCATTCCATGG + Intronic
976761764 4:88556876-88556898 CTCAAACAGTTCTCTTGCCTTGG + Intronic
978590031 4:110315015-110315037 CTCAAACAGTTCTCCTGCCTGGG - Intergenic
979199198 4:117956664-117956686 CTCTAACAGAAGACATGCTAAGG + Intergenic
979478979 4:121192433-121192455 CTCAAACAAAACTCATGCAAAGG - Intronic
979955035 4:126942078-126942100 CCCAAACTTATGTCATGGCATGG - Intergenic
980376029 4:131949973-131949995 CCCAAACATATGCCAAGCCAGGG - Intergenic
982086318 4:151840297-151840319 CCCAAACAGGAGTCATGTCAGGG + Intergenic
982297643 4:153846366-153846388 CTTAAACAGATGCCCTCCCATGG - Intergenic
985107957 4:186517119-186517141 ATCAAATAGGTTTCATGCCAGGG - Intronic
986332410 5:6727214-6727236 CTCACACAGCTGGCATGCCATGG + Intronic
995616404 5:113969126-113969148 CTCGCAGAGATGCCATGCCATGG + Intergenic
999597773 5:153224099-153224121 CTTAACCATATGTCGTGCCAAGG + Intergenic
999886725 5:155932395-155932417 ATCAAACAGTTGTCATCCAAAGG + Intronic
1000448593 5:161356491-161356513 CTAAAACAGATGTCCACCCAGGG - Intronic
1000682478 5:164202957-164202979 TGAAAACAGATGTCATGCTAAGG + Intergenic
1002826769 6:781292-781314 CTCTAACAGATTCCTTGCCATGG + Intergenic
1003775311 6:9354225-9354247 CTGGAACAGATCTCCTGCCAGGG - Intergenic
1003989290 6:11469977-11469999 CCCAAACAAATATGATGCCAGGG - Intergenic
1005616794 6:27581130-27581152 CTCAAACAGTCCTCCTGCCACGG - Intergenic
1006093738 6:31643190-31643212 CTCAAGCAGTTCTCATGCCTTGG - Intronic
1006559750 6:34900584-34900606 CTCAAACAGTTGTTATGGCCAGG - Intronic
1014781531 6:125570690-125570712 CTCATACAGGAGTCATGCCAGGG + Intergenic
1015842024 6:137487466-137487488 CTCCAAAAGAAGTAATGCCAAGG + Intergenic
1016150823 6:140740688-140740710 GTCAGACAGATTTCCTGCCATGG + Intergenic
1016329495 6:142942487-142942509 CACAAACACATCTCATGCAAAGG + Intronic
1019422778 7:958751-958773 CTCCCCAAGATGTCATGCCATGG + Intronic
1019623841 7:2005565-2005587 CTCAAGCAGTTGTCCTGCCTTGG - Intronic
1020709830 7:11593387-11593409 CTCAAAAACATGCCATGACATGG - Exonic
1023310743 7:38883729-38883751 CTCAAATATATATCATACCAGGG + Intronic
1024130949 7:46352978-46353000 CTCAAACAGAACTCATGGAATGG - Intergenic
1025020499 7:55476162-55476184 CAGAGACAGATGACATGCCAAGG - Intronic
1031048753 7:116923568-116923590 TTTAAAGAGATGTCAAGCCAAGG + Intergenic
1031889381 7:127276364-127276386 ATCAAGCAGATGTAATGGCATGG - Intergenic
1032568413 7:132972694-132972716 CTCAATCAGCTGTCATCCTATGG + Intronic
1033928440 7:146493109-146493131 CTCAAACTGAGTTCATGTCAAGG - Intronic
1034652140 7:152700055-152700077 CTGAAGCAGTTGTCAAGCCAGGG - Intergenic
1038991091 8:32869224-32869246 CTCAAGCAGTTGTCCTGCCTTGG + Intergenic
1039381705 8:37091883-37091905 CTTAAACAAAAGACATGCCATGG - Intergenic
1040612491 8:48998921-48998943 CTCACATAGTTCTCATGCCATGG - Intergenic
1040819947 8:51545578-51545600 CTCAATCCCATGTCATCCCATGG + Intronic
1041994403 8:64036070-64036092 CTCAAACAGATTTAATCCAAAGG + Intergenic
1043629180 8:82307433-82307455 ATTAAGCATATGTCATGCCAGGG - Intergenic
1046713922 8:117546420-117546442 CTGAAGAAGAGGTCATGCCAAGG - Intergenic
1052028207 9:23598476-23598498 TTCAAAAAGATGTCAGGACATGG + Intergenic
1052806929 9:33021587-33021609 CTCAAGCAGTTGTCCTGCCTTGG - Intronic
1054321818 9:63676937-63676959 CCCAAACATATGCCAAGCCAGGG - Intergenic
1057302707 9:93895963-93895985 CGGAAACAGATTTCATGCCTGGG + Intergenic
1060353715 9:122883746-122883768 CTCAAACAGTCGTCCTGCCTCGG - Intronic
1060623691 9:125091147-125091169 CTCCAACAGATGCAATACCAGGG + Intronic
1202788850 9_KI270719v1_random:63717-63739 CCCAAACATATGCCAAGCCAGGG - Intergenic
1203779151 EBV:91378-91400 CTCCAACAGATGACTTGCCTCGG + Intergenic
1185874425 X:3690809-3690831 CACTAACAGATGTGAAGCCAGGG + Intronic
1187916670 X:24159221-24159243 CTCAAGCAGTTGTCCTGCCTGGG + Intronic
1188251696 X:27903810-27903832 CTCAAACAGAAGTCAAGCACTGG - Intergenic
1189081891 X:37981774-37981796 CCCAAACCAATGTCATCCCAGGG + Intronic
1190216422 X:48482114-48482136 CTCACTCAAATGTCATCCCAGGG - Intronic
1191725431 X:64275460-64275482 CTCAAACAGTTCTCCTGCCTTGG - Intronic
1191757177 X:64606278-64606300 CTCACAAAGTTCTCATGCCATGG + Intergenic
1192140855 X:68646519-68646541 CTGAAACAGAAGTGAGGCCAGGG + Intergenic
1192685835 X:73304447-73304469 GTCACACAGTTCTCATGCCATGG + Intergenic
1194681391 X:96858385-96858407 CTCAAACAGATGTGGTGAAATGG + Intronic
1197493306 X:127146375-127146397 CTGAGTGAGATGTCATGCCAAGG - Intergenic
1198182967 X:134227374-134227396 CTCAAGAAGAAGTAATGCCAGGG - Intergenic
1199484124 X:148330276-148330298 GTCACATAGATCTCATGCCATGG + Intergenic
1200055071 X:153455987-153456009 ATCAAACAGAGGCCAGGCCAAGG + Intronic