ID: 1108714146

View in Genome Browser
Species Human (GRCh38)
Location 13:53062050-53062072
Sequence CTTCCCAAGGGGAAAATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108714135_1108714146 15 Left 1108714135 13:53062012-53062034 CCCTTCCTTGCTCTGCCTATCAA No data
Right 1108714146 13:53062050-53062072 CTTCCCAAGGGGAAAATGGGTGG No data
1108714134_1108714146 16 Left 1108714134 13:53062011-53062033 CCCCTTCCTTGCTCTGCCTATCA No data
Right 1108714146 13:53062050-53062072 CTTCCCAAGGGGAAAATGGGTGG No data
1108714139_1108714146 0 Left 1108714139 13:53062027-53062049 CCTATCAAAGAAACAGGCTTAGG No data
Right 1108714146 13:53062050-53062072 CTTCCCAAGGGGAAAATGGGTGG No data
1108714136_1108714146 14 Left 1108714136 13:53062013-53062035 CCTTCCTTGCTCTGCCTATCAAA No data
Right 1108714146 13:53062050-53062072 CTTCCCAAGGGGAAAATGGGTGG No data
1108714137_1108714146 10 Left 1108714137 13:53062017-53062039 CCTTGCTCTGCCTATCAAAGAAA No data
Right 1108714146 13:53062050-53062072 CTTCCCAAGGGGAAAATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108714146 Original CRISPR CTTCCCAAGGGGAAAATGGG TGG Intergenic
No off target data available for this crispr