ID: 1108715686

View in Genome Browser
Species Human (GRCh38)
Location 13:53075718-53075740
Sequence TCATCACCATAGAGGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108715686_1108715696 1 Left 1108715686 13:53075718-53075740 CCCTGCCCCCTCTATGGTGATGA No data
Right 1108715696 13:53075742-53075764 ATCCTGGGGGCAGAGAAAAGTGG No data
1108715686_1108715699 19 Left 1108715686 13:53075718-53075740 CCCTGCCCCCTCTATGGTGATGA No data
Right 1108715699 13:53075760-53075782 AGTGGGTTGAAAGTCCCAGTAGG No data
1108715686_1108715697 2 Left 1108715686 13:53075718-53075740 CCCTGCCCCCTCTATGGTGATGA No data
Right 1108715697 13:53075743-53075765 TCCTGGGGGCAGAGAAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108715686 Original CRISPR TCATCACCATAGAGGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr