ID: 1108715686 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:53075718-53075740 |
| Sequence | TCATCACCATAGAGGGGGCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1108715686_1108715696 | 1 | Left | 1108715686 | 13:53075718-53075740 | CCCTGCCCCCTCTATGGTGATGA | No data | ||
| Right | 1108715696 | 13:53075742-53075764 | ATCCTGGGGGCAGAGAAAAGTGG | No data | ||||
| 1108715686_1108715699 | 19 | Left | 1108715686 | 13:53075718-53075740 | CCCTGCCCCCTCTATGGTGATGA | No data | ||
| Right | 1108715699 | 13:53075760-53075782 | AGTGGGTTGAAAGTCCCAGTAGG | No data | ||||
| 1108715686_1108715697 | 2 | Left | 1108715686 | 13:53075718-53075740 | CCCTGCCCCCTCTATGGTGATGA | No data | ||
| Right | 1108715697 | 13:53075743-53075765 | TCCTGGGGGCAGAGAAAAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1108715686 | Original CRISPR | TCATCACCATAGAGGGGGCA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||