ID: 1108715930

View in Genome Browser
Species Human (GRCh38)
Location 13:53077812-53077834
Sequence ATGGTTAAGCACCATCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108715930_1108715937 25 Left 1108715930 13:53077812-53077834 CCAAGAGGATGGTGCTTAACCAT No data
Right 1108715937 13:53077860-53077882 CCAGGCCCTACCTGTAACATTGG No data
1108715930_1108715932 7 Left 1108715930 13:53077812-53077834 CCAAGAGGATGGTGCTTAACCAT No data
Right 1108715932 13:53077842-53077864 AAATCCACTTACCTGCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108715930 Original CRISPR ATGGTTAAGCACCATCCTCT TGG (reversed) Intergenic
No off target data available for this crispr