ID: 1108721419

View in Genome Browser
Species Human (GRCh38)
Location 13:53136695-53136717
Sequence AATCACATGGGTGAGCTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108721419_1108721428 28 Left 1108721419 13:53136695-53136717 CCTCTTAGCTCACCCATGTGATT No data
Right 1108721428 13:53136746-53136768 CCAGCTTCCTCATGGACTGTTGG No data
1108721419_1108721425 20 Left 1108721419 13:53136695-53136717 CCTCTTAGCTCACCCATGTGATT No data
Right 1108721425 13:53136738-53136760 CCAAGAGCCCAGCTTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108721419 Original CRISPR AATCACATGGGTGAGCTAAG AGG (reversed) Intergenic
No off target data available for this crispr