ID: 1108722587

View in Genome Browser
Species Human (GRCh38)
Location 13:53147519-53147541
Sequence AATCCCACACCCAGTGTGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108722587_1108722589 1 Left 1108722587 13:53147519-53147541 CCGAACACACTGGGTGTGGGATT No data
Right 1108722589 13:53147543-53147565 TTGTGAGGACATATAAAGTGTGG No data
1108722587_1108722590 11 Left 1108722587 13:53147519-53147541 CCGAACACACTGGGTGTGGGATT No data
Right 1108722590 13:53147553-53147575 ATATAAAGTGTGGATCTCAGTGG No data
1108722587_1108722591 26 Left 1108722587 13:53147519-53147541 CCGAACACACTGGGTGTGGGATT No data
Right 1108722591 13:53147568-53147590 CTCAGTGGATCTGCGTAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108722587 Original CRISPR AATCCCACACCCAGTGTGTT CGG (reversed) Intergenic
No off target data available for this crispr