ID: 1108726113

View in Genome Browser
Species Human (GRCh38)
Location 13:53183314-53183336
Sequence CTTGCTTCCCAGATTTACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108726108_1108726113 29 Left 1108726108 13:53183262-53183284 CCTAATTGAAGTTGGAACCAAGG No data
Right 1108726113 13:53183314-53183336 CTTGCTTCCCAGATTTACCAAGG No data
1108726110_1108726113 12 Left 1108726110 13:53183279-53183301 CCAAGGATTTGTGTCTAGTTCCT No data
Right 1108726113 13:53183314-53183336 CTTGCTTCCCAGATTTACCAAGG No data
1108726112_1108726113 -8 Left 1108726112 13:53183299-53183321 CCTATGAACAGGTCTCTTGCTTC No data
Right 1108726113 13:53183314-53183336 CTTGCTTCCCAGATTTACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108726113 Original CRISPR CTTGCTTCCCAGATTTACCA AGG Intergenic
No off target data available for this crispr