ID: 1108729038

View in Genome Browser
Species Human (GRCh38)
Location 13:53213823-53213845
Sequence CGTCATAGGCAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108729038_1108729042 -7 Left 1108729038 13:53213823-53213845 CCTTCCTCCTTCTGCCTATGACG No data
Right 1108729042 13:53213839-53213861 TATGACGTAGTGTTCTGTGTAGG No data
1108729038_1108729049 20 Left 1108729038 13:53213823-53213845 CCTTCCTCCTTCTGCCTATGACG No data
Right 1108729049 13:53213866-53213888 TCTTTAGGGGGAGAATGGGCTGG No data
1108729038_1108729047 15 Left 1108729038 13:53213823-53213845 CCTTCCTCCTTCTGCCTATGACG No data
Right 1108729047 13:53213861-53213883 GTATGTCTTTAGGGGGAGAATGG No data
1108729038_1108729045 7 Left 1108729038 13:53213823-53213845 CCTTCCTCCTTCTGCCTATGACG No data
Right 1108729045 13:53213853-53213875 CTGTGTAGGTATGTCTTTAGGGG No data
1108729038_1108729046 8 Left 1108729038 13:53213823-53213845 CCTTCCTCCTTCTGCCTATGACG No data
Right 1108729046 13:53213854-53213876 TGTGTAGGTATGTCTTTAGGGGG No data
1108729038_1108729048 16 Left 1108729038 13:53213823-53213845 CCTTCCTCCTTCTGCCTATGACG No data
Right 1108729048 13:53213862-53213884 TATGTCTTTAGGGGGAGAATGGG No data
1108729038_1108729044 6 Left 1108729038 13:53213823-53213845 CCTTCCTCCTTCTGCCTATGACG No data
Right 1108729044 13:53213852-53213874 TCTGTGTAGGTATGTCTTTAGGG No data
1108729038_1108729043 5 Left 1108729038 13:53213823-53213845 CCTTCCTCCTTCTGCCTATGACG No data
Right 1108729043 13:53213851-53213873 TTCTGTGTAGGTATGTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108729038 Original CRISPR CGTCATAGGCAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr