ID: 1108735698

View in Genome Browser
Species Human (GRCh38)
Location 13:53281509-53281531
Sequence TGCCATGTGGTCATATCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108735695_1108735698 24 Left 1108735695 13:53281462-53281484 CCAGCAATTAGGAGAAGGCTAAC No data
Right 1108735698 13:53281509-53281531 TGCCATGTGGTCATATCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108735698 Original CRISPR TGCCATGTGGTCATATCTAG AGG Intergenic
No off target data available for this crispr