ID: 1108737021

View in Genome Browser
Species Human (GRCh38)
Location 13:53294878-53294900
Sequence TCCTTGGAGAGATTAATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108737021_1108737031 12 Left 1108737021 13:53294878-53294900 CCTCAAATTAATCTCTCCAAGGA No data
Right 1108737031 13:53294913-53294935 GGTTTTTAAGGGTTTTGGAGAGG 0: 17
1: 51
2: 82
3: 85
4: 377
1108737021_1108737032 13 Left 1108737021 13:53294878-53294900 CCTCAAATTAATCTCTCCAAGGA No data
Right 1108737032 13:53294914-53294936 GTTTTTAAGGGTTTTGGAGAGGG No data
1108737021_1108737025 -10 Left 1108737021 13:53294878-53294900 CCTCAAATTAATCTCTCCAAGGA No data
Right 1108737025 13:53294891-53294913 TCTCCAAGGAGTCTGGGGTTAGG No data
1108737021_1108737033 24 Left 1108737021 13:53294878-53294900 CCTCAAATTAATCTCTCCAAGGA No data
Right 1108737033 13:53294925-53294947 TTTTGGAGAGGGCTGAAGTGTGG No data
1108737021_1108737029 1 Left 1108737021 13:53294878-53294900 CCTCAAATTAATCTCTCCAAGGA No data
Right 1108737029 13:53294902-53294924 TCTGGGGTTAGGGTTTTTAAGGG No data
1108737021_1108737028 0 Left 1108737021 13:53294878-53294900 CCTCAAATTAATCTCTCCAAGGA No data
Right 1108737028 13:53294901-53294923 GTCTGGGGTTAGGGTTTTTAAGG No data
1108737021_1108737026 -9 Left 1108737021 13:53294878-53294900 CCTCAAATTAATCTCTCCAAGGA No data
Right 1108737026 13:53294892-53294914 CTCCAAGGAGTCTGGGGTTAGGG No data
1108737021_1108737030 7 Left 1108737021 13:53294878-53294900 CCTCAAATTAATCTCTCCAAGGA No data
Right 1108737030 13:53294908-53294930 GTTAGGGTTTTTAAGGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108737021 Original CRISPR TCCTTGGAGAGATTAATTTG AGG (reversed) Intergenic
No off target data available for this crispr