ID: 1108737032

View in Genome Browser
Species Human (GRCh38)
Location 13:53294914-53294936
Sequence GTTTTTAAGGGTTTTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108737027_1108737032 -3 Left 1108737027 13:53294894-53294916 CCAAGGAGTCTGGGGTTAGGGTT No data
Right 1108737032 13:53294914-53294936 GTTTTTAAGGGTTTTGGAGAGGG No data
1108737021_1108737032 13 Left 1108737021 13:53294878-53294900 CCTCAAATTAATCTCTCCAAGGA No data
Right 1108737032 13:53294914-53294936 GTTTTTAAGGGTTTTGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108737032 Original CRISPR GTTTTTAAGGGTTTTGGAGA GGG Intergenic
No off target data available for this crispr