ID: 1108737633

View in Genome Browser
Species Human (GRCh38)
Location 13:53301246-53301268
Sequence CCAAGGAAATGCCACCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108737633_1108737641 -2 Left 1108737633 13:53301246-53301268 CCCACAGGGTGGCATTTCCTTGG No data
Right 1108737641 13:53301267-53301289 GGGGAATTCTCTATGGTCCTGGG No data
1108737633_1108737643 16 Left 1108737633 13:53301246-53301268 CCCACAGGGTGGCATTTCCTTGG No data
Right 1108737643 13:53301285-53301307 CTGGGTCTAGCTGTACTCTTCGG No data
1108737633_1108737638 -9 Left 1108737633 13:53301246-53301268 CCCACAGGGTGGCATTTCCTTGG No data
Right 1108737638 13:53301260-53301282 TTTCCTTGGGGAATTCTCTATGG No data
1108737633_1108737640 -3 Left 1108737633 13:53301246-53301268 CCCACAGGGTGGCATTTCCTTGG No data
Right 1108737640 13:53301266-53301288 TGGGGAATTCTCTATGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108737633 Original CRISPR CCAAGGAAATGCCACCCTGT GGG (reversed) Intergenic