ID: 1108737886

View in Genome Browser
Species Human (GRCh38)
Location 13:53304859-53304881
Sequence AGTGGGAAGCATTTACACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108737886_1108737890 6 Left 1108737886 13:53304859-53304881 CCACAGTGTAAATGCTTCCCACT No data
Right 1108737890 13:53304888-53304910 GTCCATCTGCAATTGGAAGTTGG No data
1108737886_1108737889 -1 Left 1108737886 13:53304859-53304881 CCACAGTGTAAATGCTTCCCACT No data
Right 1108737889 13:53304881-53304903 TGCTGATGTCCATCTGCAATTGG No data
1108737886_1108737893 20 Left 1108737886 13:53304859-53304881 CCACAGTGTAAATGCTTCCCACT No data
Right 1108737893 13:53304902-53304924 GGAAGTTGGATGGATCTCAATGG No data
1108737886_1108737892 10 Left 1108737886 13:53304859-53304881 CCACAGTGTAAATGCTTCCCACT No data
Right 1108737892 13:53304892-53304914 ATCTGCAATTGGAAGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108737886 Original CRISPR AGTGGGAAGCATTTACACTG TGG (reversed) Intergenic
No off target data available for this crispr