ID: 1108737887 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:53304876-53304898 |
| Sequence | TGCAGATGGACATCAGCAGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1108737887_1108737892 | -7 | Left | 1108737887 | 13:53304876-53304898 | CCCACTGCTGATGTCCATCTGCA | No data | ||
| Right | 1108737892 | 13:53304892-53304914 | ATCTGCAATTGGAAGTTGGATGG | No data | ||||
| 1108737887_1108737893 | 3 | Left | 1108737887 | 13:53304876-53304898 | CCCACTGCTGATGTCCATCTGCA | No data | ||
| Right | 1108737893 | 13:53304902-53304924 | GGAAGTTGGATGGATCTCAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1108737887 | Original CRISPR | TGCAGATGGACATCAGCAGT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||