ID: 1108737887

View in Genome Browser
Species Human (GRCh38)
Location 13:53304876-53304898
Sequence TGCAGATGGACATCAGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108737887_1108737892 -7 Left 1108737887 13:53304876-53304898 CCCACTGCTGATGTCCATCTGCA No data
Right 1108737892 13:53304892-53304914 ATCTGCAATTGGAAGTTGGATGG No data
1108737887_1108737893 3 Left 1108737887 13:53304876-53304898 CCCACTGCTGATGTCCATCTGCA No data
Right 1108737893 13:53304902-53304924 GGAAGTTGGATGGATCTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108737887 Original CRISPR TGCAGATGGACATCAGCAGT GGG (reversed) Intergenic
No off target data available for this crispr