ID: 1108740078

View in Genome Browser
Species Human (GRCh38)
Location 13:53328027-53328049
Sequence AATTCAGTTAGAAAGATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108740078_1108740080 21 Left 1108740078 13:53328027-53328049 CCTGACATCTTTCTAACTGAATT No data
Right 1108740080 13:53328071-53328093 GAAGGTAGATCTATTAGTCATGG No data
1108740078_1108740079 3 Left 1108740078 13:53328027-53328049 CCTGACATCTTTCTAACTGAATT No data
Right 1108740079 13:53328053-53328075 TTTCTTTTTCTTTTATTTGAAGG No data
1108740078_1108740081 27 Left 1108740078 13:53328027-53328049 CCTGACATCTTTCTAACTGAATT No data
Right 1108740081 13:53328077-53328099 AGATCTATTAGTCATGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108740078 Original CRISPR AATTCAGTTAGAAAGATGTC AGG (reversed) Intergenic
No off target data available for this crispr