ID: 1108740472

View in Genome Browser
Species Human (GRCh38)
Location 13:53332161-53332183
Sequence ACTAGTTTTCCCATTGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108740465_1108740472 11 Left 1108740465 13:53332127-53332149 CCCTTGTGACTGGAGGGATGGGG No data
Right 1108740472 13:53332161-53332183 ACTAGTTTTCCCATTGGTGTGGG No data
1108740467_1108740472 10 Left 1108740467 13:53332128-53332150 CCTTGTGACTGGAGGGATGGGGC No data
Right 1108740472 13:53332161-53332183 ACTAGTTTTCCCATTGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108740472 Original CRISPR ACTAGTTTTCCCATTGGTGT GGG Intergenic
No off target data available for this crispr