ID: 1108745470

View in Genome Browser
Species Human (GRCh38)
Location 13:53388912-53388934
Sequence CCATTACAACCAAAGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108745470_1108745473 -7 Left 1108745470 13:53388912-53388934 CCTATTTCCTTTGGTTGTAATGG No data
Right 1108745473 13:53388928-53388950 GTAATGGTTTTATAGCTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108745470 Original CRISPR CCATTACAACCAAAGGAAAT AGG (reversed) Intergenic
No off target data available for this crispr