ID: 1108752820

View in Genome Browser
Species Human (GRCh38)
Location 13:53465487-53465509
Sequence CTTAAAACACAGTTCGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108752820_1108752825 0 Left 1108752820 13:53465487-53465509 CCCAGCCCGAACTGTGTTTTAAG No data
Right 1108752825 13:53465510-53465532 TTTAGTTGGAAGCCATTGCATGG No data
1108752820_1108752826 11 Left 1108752820 13:53465487-53465509 CCCAGCCCGAACTGTGTTTTAAG No data
Right 1108752826 13:53465521-53465543 GCCATTGCATGGTTTTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108752820 Original CRISPR CTTAAAACACAGTTCGGGCT GGG (reversed) Intergenic
No off target data available for this crispr