ID: 1108755921

View in Genome Browser
Species Human (GRCh38)
Location 13:53502310-53502332
Sequence TGTGATTAGCTTACAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108755920_1108755921 -1 Left 1108755920 13:53502288-53502310 CCTTTGCTATTGTGAACAATGCT No data
Right 1108755921 13:53502310-53502332 TGTGATTAGCTTACAAACACAGG No data
1108755919_1108755921 4 Left 1108755919 13:53502283-53502305 CCAAACCTTTGCTATTGTGAACA No data
Right 1108755921 13:53502310-53502332 TGTGATTAGCTTACAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108755921 Original CRISPR TGTGATTAGCTTACAAACAC AGG Intergenic
No off target data available for this crispr