ID: 1108761384

View in Genome Browser
Species Human (GRCh38)
Location 13:53570036-53570058
Sequence AACCTAAGATTGCTGTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108761384_1108761386 -2 Left 1108761384 13:53570036-53570058 CCCTGGTACAGCAATCTTAGGTT No data
Right 1108761386 13:53570057-53570079 TTTTTAAGATCTGCTTATTTTGG No data
1108761384_1108761387 11 Left 1108761384 13:53570036-53570058 CCCTGGTACAGCAATCTTAGGTT No data
Right 1108761387 13:53570070-53570092 CTTATTTTGGAACAGAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108761384 Original CRISPR AACCTAAGATTGCTGTACCA GGG (reversed) Intergenic
No off target data available for this crispr