ID: 1108761396

View in Genome Browser
Species Human (GRCh38)
Location 13:53570165-53570187
Sequence ATGGATATGCAGAAAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108761396_1108761402 6 Left 1108761396 13:53570165-53570187 CCTTCCCCTTTCTGCATATCCAT No data
Right 1108761402 13:53570194-53570216 TCTGTGAAGTCTTTGCCTGATGG No data
1108761396_1108761403 7 Left 1108761396 13:53570165-53570187 CCTTCCCCTTTCTGCATATCCAT No data
Right 1108761403 13:53570195-53570217 CTGTGAAGTCTTTGCCTGATGGG No data
1108761396_1108761407 21 Left 1108761396 13:53570165-53570187 CCTTCCCCTTTCTGCATATCCAT No data
Right 1108761407 13:53570209-53570231 CCTGATGGGAGGCTTAGGTGAGG No data
1108761396_1108761405 16 Left 1108761396 13:53570165-53570187 CCTTCCCCTTTCTGCATATCCAT No data
Right 1108761405 13:53570204-53570226 CTTTGCCTGATGGGAGGCTTAGG No data
1108761396_1108761404 10 Left 1108761396 13:53570165-53570187 CCTTCCCCTTTCTGCATATCCAT No data
Right 1108761404 13:53570198-53570220 TGAAGTCTTTGCCTGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108761396 Original CRISPR ATGGATATGCAGAAAGGGGA AGG (reversed) Intergenic
No off target data available for this crispr