ID: 1108766342

View in Genome Browser
Species Human (GRCh38)
Location 13:53634780-53634802
Sequence CATTGTGAACATAGTGCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108766338_1108766342 26 Left 1108766338 13:53634731-53634753 CCAGTTTTCTGTGCAATAAAATG No data
Right 1108766342 13:53634780-53634802 CATTGTGAACATAGTGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108766342 Original CRISPR CATTGTGAACATAGTGCATT GGG Intergenic
No off target data available for this crispr