ID: 1108770062

View in Genome Browser
Species Human (GRCh38)
Location 13:53688787-53688809
Sequence AGGTATGTACAGGTCGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108770059_1108770062 -9 Left 1108770059 13:53688773-53688795 CCGCATTGAGTTTGAGGTATGTA No data
Right 1108770062 13:53688787-53688809 AGGTATGTACAGGTCGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108770062 Original CRISPR AGGTATGTACAGGTCGTACA GGG Intergenic
No off target data available for this crispr