ID: 1108770091

View in Genome Browser
Species Human (GRCh38)
Location 13:53689213-53689235
Sequence AATGGGAAAGTTAAAATTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108770088_1108770091 -6 Left 1108770088 13:53689196-53689218 CCATTTATTTGGACAATAATGGG No data
Right 1108770091 13:53689213-53689235 AATGGGAAAGTTAAAATTTAGGG No data
1108770086_1108770091 -1 Left 1108770086 13:53689191-53689213 CCAGGCCATTTATTTGGACAATA No data
Right 1108770091 13:53689213-53689235 AATGGGAAAGTTAAAATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108770091 Original CRISPR AATGGGAAAGTTAAAATTTA GGG Intergenic
No off target data available for this crispr