ID: 1108770950

View in Genome Browser
Species Human (GRCh38)
Location 13:53699947-53699969
Sequence TTTTAGCCATGGCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108770950_1108770960 14 Left 1108770950 13:53699947-53699969 CCCAGCTCCAGCCATGGCTAAAA No data
Right 1108770960 13:53699984-53700006 GCTTGGGCCATGGCTTCAGAGGG 0: 110
1: 317
2: 720
3: 1144
4: 1940
1108770950_1108770958 4 Left 1108770950 13:53699947-53699969 CCCAGCTCCAGCCATGGCTAAAA No data
Right 1108770958 13:53699974-53699996 CCAAAGTAAAGCTTGGGCCATGG No data
1108770950_1108770959 13 Left 1108770950 13:53699947-53699969 CCCAGCTCCAGCCATGGCTAAAA No data
Right 1108770959 13:53699983-53700005 AGCTTGGGCCATGGCTTCAGAGG 0: 104
1: 314
2: 756
3: 1216
4: 1535
1108770950_1108770956 -2 Left 1108770950 13:53699947-53699969 CCCAGCTCCAGCCATGGCTAAAA No data
Right 1108770956 13:53699968-53699990 AAAGGTCCAAAGTAAAGCTTGGG No data
1108770950_1108770955 -3 Left 1108770950 13:53699947-53699969 CCCAGCTCCAGCCATGGCTAAAA No data
Right 1108770955 13:53699967-53699989 AAAAGGTCCAAAGTAAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108770950 Original CRISPR TTTTAGCCATGGCTGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr