ID: 1108773500

View in Genome Browser
Species Human (GRCh38)
Location 13:53734310-53734332
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108773497_1108773500 -2 Left 1108773497 13:53734289-53734311 CCTCTGGGGACCCAAGCACTTCT No data
Right 1108773500 13:53734310-53734332 CTCATTTTGTCCTCTGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108773500 Original CRISPR CTCATTTTGTCCTCTGTATC TGG Intergenic
No off target data available for this crispr