ID: 1108774907

View in Genome Browser
Species Human (GRCh38)
Location 13:53753900-53753922
Sequence CTGTCATGCTGGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108774900_1108774907 14 Left 1108774900 13:53753863-53753885 CCTAGAATGAAGAAGCAGATCTA No data
Right 1108774907 13:53753900-53753922 CTGTCATGCTGGAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108774907 Original CRISPR CTGTCATGCTGGAGGGAAGA GGG Intergenic
No off target data available for this crispr