ID: 1108779585

View in Genome Browser
Species Human (GRCh38)
Location 13:53812901-53812923
Sequence GCTTCTTTTCAGGAGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108779577_1108779585 2 Left 1108779577 13:53812876-53812898 CCTTCCCAGTTAATTTCATCCTG No data
Right 1108779585 13:53812901-53812923 GCTTCTTTTCAGGAGAGGGAGGG No data
1108779579_1108779585 -3 Left 1108779579 13:53812881-53812903 CCAGTTAATTTCATCCTGCTGCT No data
Right 1108779585 13:53812901-53812923 GCTTCTTTTCAGGAGAGGGAGGG No data
1108779578_1108779585 -2 Left 1108779578 13:53812880-53812902 CCCAGTTAATTTCATCCTGCTGC No data
Right 1108779585 13:53812901-53812923 GCTTCTTTTCAGGAGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108779585 Original CRISPR GCTTCTTTTCAGGAGAGGGA GGG Intergenic
No off target data available for this crispr