ID: 1108781391

View in Genome Browser
Species Human (GRCh38)
Location 13:53840369-53840391
Sequence TTGTTTATACAGTTGAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108781391_1108781392 27 Left 1108781391 13:53840369-53840391 CCAAACTTCAACTGTATAAACAA No data
Right 1108781392 13:53840419-53840441 AAAAATATCCAAAAGTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108781391 Original CRISPR TTGTTTATACAGTTGAAGTT TGG (reversed) Intergenic
No off target data available for this crispr