ID: 1108786276

View in Genome Browser
Species Human (GRCh38)
Location 13:53905745-53905767
Sequence CCACTTGACCCAAGGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108786276_1108786283 11 Left 1108786276 13:53905745-53905767 CCAGCTGCCCTTGGGTCAAGTGG No data
Right 1108786283 13:53905779-53905801 ATGCCCTATGAAAAGAGAAGGGG No data
1108786276_1108786281 9 Left 1108786276 13:53905745-53905767 CCAGCTGCCCTTGGGTCAAGTGG No data
Right 1108786281 13:53905777-53905799 TCATGCCCTATGAAAAGAGAAGG No data
1108786276_1108786282 10 Left 1108786276 13:53905745-53905767 CCAGCTGCCCTTGGGTCAAGTGG No data
Right 1108786282 13:53905778-53905800 CATGCCCTATGAAAAGAGAAGGG No data
1108786276_1108786285 13 Left 1108786276 13:53905745-53905767 CCAGCTGCCCTTGGGTCAAGTGG No data
Right 1108786285 13:53905781-53905803 GCCCTATGAAAAGAGAAGGGGGG No data
1108786276_1108786284 12 Left 1108786276 13:53905745-53905767 CCAGCTGCCCTTGGGTCAAGTGG No data
Right 1108786284 13:53905780-53905802 TGCCCTATGAAAAGAGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108786276 Original CRISPR CCACTTGACCCAAGGGCAGC TGG (reversed) Intergenic
No off target data available for this crispr