ID: 1108792121

View in Genome Browser
Species Human (GRCh38)
Location 13:53982932-53982954
Sequence GGTGCTTTATCTGGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108792116_1108792121 9 Left 1108792116 13:53982900-53982922 CCATGTGATTAGGCCATTTGGGT No data
Right 1108792121 13:53982932-53982954 GGTGCTTTATCTGGAGAAGAGGG No data
1108792118_1108792121 -4 Left 1108792118 13:53982913-53982935 CCATTTGGGTTTGTTAATTGGTG No data
Right 1108792121 13:53982932-53982954 GGTGCTTTATCTGGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108792121 Original CRISPR GGTGCTTTATCTGGAGAAGA GGG Intergenic