ID: 1108795849

View in Genome Browser
Species Human (GRCh38)
Location 13:54029653-54029675
Sequence AACACGCAGGTGAATACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108795849_1108795853 18 Left 1108795849 13:54029653-54029675 CCATTTGTATTCACCTGCGTGTT No data
Right 1108795853 13:54029694-54029716 GTTAGATGTGAAATGTGACTTGG No data
1108795849_1108795851 -6 Left 1108795849 13:54029653-54029675 CCATTTGTATTCACCTGCGTGTT No data
Right 1108795851 13:54029670-54029692 CGTGTTTCAATCCTGTTAAGTGG No data
1108795849_1108795854 27 Left 1108795849 13:54029653-54029675 CCATTTGTATTCACCTGCGTGTT No data
Right 1108795854 13:54029703-54029725 GAAATGTGACTTGGAATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108795849 Original CRISPR AACACGCAGGTGAATACAAA TGG (reversed) Intergenic
No off target data available for this crispr