ID: 1108800068

View in Genome Browser
Species Human (GRCh38)
Location 13:54084095-54084117
Sequence CTGTGTGACTGGCAGGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108800068_1108800075 9 Left 1108800068 13:54084095-54084117 CCGACCACCTGCCAGTCACACAG No data
Right 1108800075 13:54084127-54084149 TTGCTAGGACTGAATACCACAGG No data
1108800068_1108800076 10 Left 1108800068 13:54084095-54084117 CCGACCACCTGCCAGTCACACAG No data
Right 1108800076 13:54084128-54084150 TGCTAGGACTGAATACCACAGGG No data
1108800068_1108800077 18 Left 1108800068 13:54084095-54084117 CCGACCACCTGCCAGTCACACAG No data
Right 1108800077 13:54084136-54084158 CTGAATACCACAGGGAGCAAAGG No data
1108800068_1108800073 -6 Left 1108800068 13:54084095-54084117 CCGACCACCTGCCAGTCACACAG No data
Right 1108800073 13:54084112-54084134 ACACAGTTGGCCTCTTTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108800068 Original CRISPR CTGTGTGACTGGCAGGTGGT CGG (reversed) Intergenic
No off target data available for this crispr