ID: 1108802743

View in Genome Browser
Species Human (GRCh38)
Location 13:54119482-54119504
Sequence AAACTTGTGCTTCGATAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108802743_1108802744 14 Left 1108802743 13:54119482-54119504 CCTCTCTATCGAAGCACAAGTTT No data
Right 1108802744 13:54119519-54119541 TGTAGTTTGTGTAGTAATGTTGG No data
1108802743_1108802745 27 Left 1108802743 13:54119482-54119504 CCTCTCTATCGAAGCACAAGTTT No data
Right 1108802745 13:54119532-54119554 GTAATGTTGGAGACATTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108802743 Original CRISPR AAACTTGTGCTTCGATAGAG AGG (reversed) Intergenic
No off target data available for this crispr