ID: 1108804735

View in Genome Browser
Species Human (GRCh38)
Location 13:54140543-54140565
Sequence ATGTTCAAGGAACAGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108804735_1108804738 -3 Left 1108804735 13:54140543-54140565 CCTCCTGGCTGTTCCTTGAACAT No data
Right 1108804738 13:54140563-54140585 CATAACAAACACACTCCTTGTGG No data
1108804735_1108804741 20 Left 1108804735 13:54140543-54140565 CCTCCTGGCTGTTCCTTGAACAT No data
Right 1108804741 13:54140586-54140608 CCAATGCATCAATTCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108804735 Original CRISPR ATGTTCAAGGAACAGCCAGG AGG (reversed) Intergenic
No off target data available for this crispr