ID: 1108804738

View in Genome Browser
Species Human (GRCh38)
Location 13:54140563-54140585
Sequence CATAACAAACACACTCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108804734_1108804738 -2 Left 1108804734 13:54140542-54140564 CCCTCCTGGCTGTTCCTTGAACA No data
Right 1108804738 13:54140563-54140585 CATAACAAACACACTCCTTGTGG No data
1108804733_1108804738 10 Left 1108804733 13:54140530-54140552 CCAGCTACTCTGCCCTCCTGGCT No data
Right 1108804738 13:54140563-54140585 CATAACAAACACACTCCTTGTGG No data
1108804736_1108804738 -6 Left 1108804736 13:54140546-54140568 CCTGGCTGTTCCTTGAACATAAC No data
Right 1108804738 13:54140563-54140585 CATAACAAACACACTCCTTGTGG No data
1108804735_1108804738 -3 Left 1108804735 13:54140543-54140565 CCTCCTGGCTGTTCCTTGAACAT No data
Right 1108804738 13:54140563-54140585 CATAACAAACACACTCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108804738 Original CRISPR CATAACAAACACACTCCTTG TGG Intergenic
No off target data available for this crispr