ID: 1108819737

View in Genome Browser
Species Human (GRCh38)
Location 13:54334153-54334175
Sequence CTGGCTAAACAGATTATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108819728_1108819737 14 Left 1108819728 13:54334116-54334138 CCCATTCCCAGTGTGATTCAGAA No data
Right 1108819737 13:54334153-54334175 CTGGCTAAACAGATTATGGAGGG No data
1108819729_1108819737 13 Left 1108819729 13:54334117-54334139 CCATTCCCAGTGTGATTCAGAAG No data
Right 1108819737 13:54334153-54334175 CTGGCTAAACAGATTATGGAGGG No data
1108819725_1108819737 26 Left 1108819725 13:54334104-54334126 CCCACTCACTACCCCATTCCCAG No data
Right 1108819737 13:54334153-54334175 CTGGCTAAACAGATTATGGAGGG No data
1108819731_1108819737 7 Left 1108819731 13:54334123-54334145 CCAGTGTGATTCAGAAGCTTATA No data
Right 1108819737 13:54334153-54334175 CTGGCTAAACAGATTATGGAGGG No data
1108819730_1108819737 8 Left 1108819730 13:54334122-54334144 CCCAGTGTGATTCAGAAGCTTAT No data
Right 1108819737 13:54334153-54334175 CTGGCTAAACAGATTATGGAGGG No data
1108819727_1108819737 15 Left 1108819727 13:54334115-54334137 CCCCATTCCCAGTGTGATTCAGA No data
Right 1108819737 13:54334153-54334175 CTGGCTAAACAGATTATGGAGGG No data
1108819726_1108819737 25 Left 1108819726 13:54334105-54334127 CCACTCACTACCCCATTCCCAGT No data
Right 1108819737 13:54334153-54334175 CTGGCTAAACAGATTATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108819737 Original CRISPR CTGGCTAAACAGATTATGGA GGG Intergenic
No off target data available for this crispr