ID: 1108820024

View in Genome Browser
Species Human (GRCh38)
Location 13:54337001-54337023
Sequence TGTGACTACCACTAAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108820024_1108820032 23 Left 1108820024 13:54337001-54337023 CCTGCCACTTAGTGGTAGTCACA No data
Right 1108820032 13:54337047-54337069 TCTTAGGAATGAGTCATGCTGGG No data
1108820024_1108820033 24 Left 1108820024 13:54337001-54337023 CCTGCCACTTAGTGGTAGTCACA No data
Right 1108820033 13:54337048-54337070 CTTAGGAATGAGTCATGCTGGGG No data
1108820024_1108820031 22 Left 1108820024 13:54337001-54337023 CCTGCCACTTAGTGGTAGTCACA No data
Right 1108820031 13:54337046-54337068 ATCTTAGGAATGAGTCATGCTGG No data
1108820024_1108820028 7 Left 1108820024 13:54337001-54337023 CCTGCCACTTAGTGGTAGTCACA No data
Right 1108820028 13:54337031-54337053 GTCCCGTGCTAAGAGATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108820024 Original CRISPR TGTGACTACCACTAAGTGGC AGG (reversed) Intergenic