ID: 1108820026

View in Genome Browser
Species Human (GRCh38)
Location 13:54337005-54337027
Sequence CACCTGTGACTACCACTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108820026_1108820028 3 Left 1108820026 13:54337005-54337027 CCACTTAGTGGTAGTCACAGGTG No data
Right 1108820028 13:54337031-54337053 GTCCCGTGCTAAGAGATCTTAGG No data
1108820026_1108820033 20 Left 1108820026 13:54337005-54337027 CCACTTAGTGGTAGTCACAGGTG No data
Right 1108820033 13:54337048-54337070 CTTAGGAATGAGTCATGCTGGGG No data
1108820026_1108820032 19 Left 1108820026 13:54337005-54337027 CCACTTAGTGGTAGTCACAGGTG No data
Right 1108820032 13:54337047-54337069 TCTTAGGAATGAGTCATGCTGGG No data
1108820026_1108820031 18 Left 1108820026 13:54337005-54337027 CCACTTAGTGGTAGTCACAGGTG No data
Right 1108820031 13:54337046-54337068 ATCTTAGGAATGAGTCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108820026 Original CRISPR CACCTGTGACTACCACTAAG TGG (reversed) Intergenic
No off target data available for this crispr