ID: 1108820028

View in Genome Browser
Species Human (GRCh38)
Location 13:54337031-54337053
Sequence GTCCCGTGCTAAGAGATCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108820024_1108820028 7 Left 1108820024 13:54337001-54337023 CCTGCCACTTAGTGGTAGTCACA No data
Right 1108820028 13:54337031-54337053 GTCCCGTGCTAAGAGATCTTAGG No data
1108820026_1108820028 3 Left 1108820026 13:54337005-54337027 CCACTTAGTGGTAGTCACAGGTG No data
Right 1108820028 13:54337031-54337053 GTCCCGTGCTAAGAGATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108820028 Original CRISPR GTCCCGTGCTAAGAGATCTT AGG Intergenic
No off target data available for this crispr