ID: 1108820028 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:54337031-54337053 |
Sequence | GTCCCGTGCTAAGAGATCTT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1108820024_1108820028 | 7 | Left | 1108820024 | 13:54337001-54337023 | CCTGCCACTTAGTGGTAGTCACA | No data | ||
Right | 1108820028 | 13:54337031-54337053 | GTCCCGTGCTAAGAGATCTTAGG | No data | ||||
1108820026_1108820028 | 3 | Left | 1108820026 | 13:54337005-54337027 | CCACTTAGTGGTAGTCACAGGTG | No data | ||
Right | 1108820028 | 13:54337031-54337053 | GTCCCGTGCTAAGAGATCTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1108820028 | Original CRISPR | GTCCCGTGCTAAGAGATCTT AGG | Intergenic | ||