ID: 1108820031

View in Genome Browser
Species Human (GRCh38)
Location 13:54337046-54337068
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108820026_1108820031 18 Left 1108820026 13:54337005-54337027 CCACTTAGTGGTAGTCACAGGTG No data
Right 1108820031 13:54337046-54337068 ATCTTAGGAATGAGTCATGCTGG No data
1108820029_1108820031 -10 Left 1108820029 13:54337033-54337055 CCCGTGCTAAGAGATCTTAGGAA No data
Right 1108820031 13:54337046-54337068 ATCTTAGGAATGAGTCATGCTGG No data
1108820024_1108820031 22 Left 1108820024 13:54337001-54337023 CCTGCCACTTAGTGGTAGTCACA No data
Right 1108820031 13:54337046-54337068 ATCTTAGGAATGAGTCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108820031 Original CRISPR ATCTTAGGAATGAGTCATGC TGG Intergenic