ID: 1108820032

View in Genome Browser
Species Human (GRCh38)
Location 13:54337047-54337069
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108820030_1108820032 -10 Left 1108820030 13:54337034-54337056 CCGTGCTAAGAGATCTTAGGAAT No data
Right 1108820032 13:54337047-54337069 TCTTAGGAATGAGTCATGCTGGG No data
1108820026_1108820032 19 Left 1108820026 13:54337005-54337027 CCACTTAGTGGTAGTCACAGGTG No data
Right 1108820032 13:54337047-54337069 TCTTAGGAATGAGTCATGCTGGG No data
1108820029_1108820032 -9 Left 1108820029 13:54337033-54337055 CCCGTGCTAAGAGATCTTAGGAA No data
Right 1108820032 13:54337047-54337069 TCTTAGGAATGAGTCATGCTGGG No data
1108820024_1108820032 23 Left 1108820024 13:54337001-54337023 CCTGCCACTTAGTGGTAGTCACA No data
Right 1108820032 13:54337047-54337069 TCTTAGGAATGAGTCATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108820032 Original CRISPR TCTTAGGAATGAGTCATGCT GGG Intergenic