ID: 1108820033

View in Genome Browser
Species Human (GRCh38)
Location 13:54337048-54337070
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108820026_1108820033 20 Left 1108820026 13:54337005-54337027 CCACTTAGTGGTAGTCACAGGTG No data
Right 1108820033 13:54337048-54337070 CTTAGGAATGAGTCATGCTGGGG No data
1108820030_1108820033 -9 Left 1108820030 13:54337034-54337056 CCGTGCTAAGAGATCTTAGGAAT No data
Right 1108820033 13:54337048-54337070 CTTAGGAATGAGTCATGCTGGGG No data
1108820029_1108820033 -8 Left 1108820029 13:54337033-54337055 CCCGTGCTAAGAGATCTTAGGAA No data
Right 1108820033 13:54337048-54337070 CTTAGGAATGAGTCATGCTGGGG No data
1108820024_1108820033 24 Left 1108820024 13:54337001-54337023 CCTGCCACTTAGTGGTAGTCACA No data
Right 1108820033 13:54337048-54337070 CTTAGGAATGAGTCATGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108820033 Original CRISPR CTTAGGAATGAGTCATGCTG GGG Intergenic