ID: 1108824492

View in Genome Browser
Species Human (GRCh38)
Location 13:54395765-54395787
Sequence TGGATTTATAGCCAAGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108824488_1108824492 24 Left 1108824488 13:54395718-54395740 CCTCAGTACAGATCTAGGCTCAA No data
Right 1108824492 13:54395765-54395787 TGGATTTATAGCCAAGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108824492 Original CRISPR TGGATTTATAGCCAAGGAGT GGG Intergenic
No off target data available for this crispr