ID: 1108827331

View in Genome Browser
Species Human (GRCh38)
Location 13:54429656-54429678
Sequence CTGGAGACAGAGATAGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108827331_1108827334 -1 Left 1108827331 13:54429656-54429678 CCTTTCACTATCTCTGTCTCCAG No data
Right 1108827334 13:54429678-54429700 GGCCCCCTTATTAGCATCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108827331 Original CRISPR CTGGAGACAGAGATAGTGAA AGG (reversed) Intergenic
No off target data available for this crispr