ID: 1108832232

View in Genome Browser
Species Human (GRCh38)
Location 13:54494523-54494545
Sequence TATTACCTATAGAAGATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108832231_1108832232 -7 Left 1108832231 13:54494507-54494529 CCTTTAAAAAATGGAATATTACC No data
Right 1108832232 13:54494523-54494545 TATTACCTATAGAAGATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108832232 Original CRISPR TATTACCTATAGAAGATAGA TGG Intergenic
No off target data available for this crispr