ID: 1108836637

View in Genome Browser
Species Human (GRCh38)
Location 13:54558118-54558140
Sequence TACTCTCCTCCTCTTAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108836630_1108836637 18 Left 1108836630 13:54558077-54558099 CCCAAGCAAGATTCCTGCCAGTT No data
Right 1108836637 13:54558118-54558140 TACTCTCCTCCTCTTAAGTGAGG No data
1108836629_1108836637 19 Left 1108836629 13:54558076-54558098 CCCCAAGCAAGATTCCTGCCAGT No data
Right 1108836637 13:54558118-54558140 TACTCTCCTCCTCTTAAGTGAGG No data
1108836635_1108836637 1 Left 1108836635 13:54558094-54558116 CCAGTTGGACTTTATGGCCTTGT No data
Right 1108836637 13:54558118-54558140 TACTCTCCTCCTCTTAAGTGAGG No data
1108836627_1108836637 21 Left 1108836627 13:54558074-54558096 CCCCCCAAGCAAGATTCCTGCCA No data
Right 1108836637 13:54558118-54558140 TACTCTCCTCCTCTTAAGTGAGG No data
1108836631_1108836637 17 Left 1108836631 13:54558078-54558100 CCAAGCAAGATTCCTGCCAGTTG No data
Right 1108836637 13:54558118-54558140 TACTCTCCTCCTCTTAAGTGAGG No data
1108836634_1108836637 5 Left 1108836634 13:54558090-54558112 CCTGCCAGTTGGACTTTATGGCC No data
Right 1108836637 13:54558118-54558140 TACTCTCCTCCTCTTAAGTGAGG No data
1108836628_1108836637 20 Left 1108836628 13:54558075-54558097 CCCCCAAGCAAGATTCCTGCCAG No data
Right 1108836637 13:54558118-54558140 TACTCTCCTCCTCTTAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108836637 Original CRISPR TACTCTCCTCCTCTTAAGTG AGG Intergenic
No off target data available for this crispr