ID: 1108844180

View in Genome Browser
Species Human (GRCh38)
Location 13:54658775-54658797
Sequence CACAGCCTGTCAGGCCGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108844180_1108844182 0 Left 1108844180 13:54658775-54658797 CCTACTCGGCCTGACAGGCTGTG No data
Right 1108844182 13:54658798-54658820 CTCCGCTCGTTCTATCAACCTGG No data
1108844180_1108844186 18 Left 1108844180 13:54658775-54658797 CCTACTCGGCCTGACAGGCTGTG No data
Right 1108844186 13:54658816-54658838 CCTGGATCCCAGGCCTGCCAAGG No data
1108844180_1108844188 24 Left 1108844180 13:54658775-54658797 CCTACTCGGCCTGACAGGCTGTG No data
Right 1108844188 13:54658822-54658844 TCCCAGGCCTGCCAAGGGCGTGG No data
1108844180_1108844187 19 Left 1108844180 13:54658775-54658797 CCTACTCGGCCTGACAGGCTGTG No data
Right 1108844187 13:54658817-54658839 CTGGATCCCAGGCCTGCCAAGGG No data
1108844180_1108844184 8 Left 1108844180 13:54658775-54658797 CCTACTCGGCCTGACAGGCTGTG No data
Right 1108844184 13:54658806-54658828 GTTCTATCAACCTGGATCCCAGG No data
1108844180_1108844191 29 Left 1108844180 13:54658775-54658797 CCTACTCGGCCTGACAGGCTGTG No data
Right 1108844191 13:54658827-54658849 GGCCTGCCAAGGGCGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108844180 Original CRISPR CACAGCCTGTCAGGCCGAGT AGG (reversed) Intergenic